ID: 1078470158_1078470165

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1078470158 1078470165
Species Human (GRCh38) Human (GRCh38)
Location 11:11580149-11580171 11:11580181-11580203
Sequence CCACTAACTCACCATTGTGACCT CACATTCCATGTTTGGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122} {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!