ID: 1078506757_1078506765

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1078506757 1078506765
Species Human (GRCh38) Human (GRCh38)
Location 11:11956285-11956307 11:11956331-11956353
Sequence CCAGCACTGATTGGACTGCCCTA AATGGGCCACTGTTTTGACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70} {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!