ID: 1078615496_1078615504

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1078615496 1078615504
Species Human (GRCh38) Human (GRCh38)
Location 11:12861648-12861670 11:12861694-12861716
Sequence CCCACCACCCACAGCATACAAAC AGATAAATTTCAGCTGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 273} {0: 1, 1: 2, 2: 29, 3: 250, 4: 4078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!