ID: 1078659650_1078659662

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1078659650 1078659662
Species Human (GRCh38) Human (GRCh38)
Location 11:13277214-13277236 11:13277266-13277288
Sequence CCGGAGGGAGAGAGGGAGTCAGG GGGGAGAAGAAGAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 100, 4: 679} {0: 1, 1: 5, 2: 64, 3: 709, 4: 4143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!