ID: 1078730563_1078730565

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1078730563 1078730565
Species Human (GRCh38) Human (GRCh38)
Location 11:13970411-13970433 11:13970434-13970456
Sequence CCCTCTCTACAGTTGTGGTTGAG ATATTTGCCAATATGTCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97} {0: 1, 1: 0, 2: 1, 3: 19, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!