ID: 1078734750_1078734755

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1078734750 1078734755
Species Human (GRCh38) Human (GRCh38)
Location 11:14009761-14009783 11:14009782-14009804
Sequence CCCATACATGGCACCTTCTTGCT CTGCATCTTCATGTGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 168} {0: 1, 1: 2, 2: 14, 3: 95, 4: 580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!