ID: 1078742108_1078742111

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1078742108 1078742111
Species Human (GRCh38) Human (GRCh38)
Location 11:14076548-14076570 11:14076580-14076602
Sequence CCTGACACAAAAAATTTAAATAG CATCATATACTCATGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 780} {0: 1, 1: 0, 2: 3, 3: 33, 4: 774}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!