ID: 1078747886_1078747892

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1078747886 1078747892
Species Human (GRCh38) Human (GRCh38)
Location 11:14132622-14132644 11:14132641-14132663
Sequence CCTCAGTGTCCAGGGCCCGCCAC CCACTGTGCTTGGCACATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 257} {0: 1, 1: 1, 2: 12, 3: 98, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!