ID: 1078749248_1078749256

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1078749248 1078749256
Species Human (GRCh38) Human (GRCh38)
Location 11:14144209-14144231 11:14144256-14144278
Sequence CCTTCCATCTTCTAAAAGGGTAT AATGGAAAGAAGACATAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 197} {0: 1, 1: 0, 2: 5, 3: 98, 4: 929}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!