ID: 1078811220_1078811227

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1078811220 1078811227
Species Human (GRCh38) Human (GRCh38)
Location 11:14766284-14766306 11:14766336-14766358
Sequence CCAAAATTATAATTTATGAGGAC CTGAATACTCAGGTTAAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 257} {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!