|
Left Crispr |
Right Crispr |
| Crispr ID |
1078832529 |
1078832536 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:14991391-14991413
|
11:14991421-14991443
|
| Sequence |
CCCATATCGCAAAGTGTGTCCAC |
TGATATGGTTCATAATATCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 21, 3: 147, 4: 704} |
{0: 21, 1: 112, 2: 680, 3: 1221, 4: 1627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|