ID: 1078832529_1078832539

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1078832529 1078832539
Species Human (GRCh38) Human (GRCh38)
Location 11:14991391-14991413 11:14991431-14991453
Sequence CCCATATCGCAAAGTGTGTCCAC CATAATATCCAGGGCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 147, 4: 704} {0: 1, 1: 12, 2: 81, 3: 258, 4: 913}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!