ID: 1078851939_1078851944

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1078851939 1078851944
Species Human (GRCh38) Human (GRCh38)
Location 11:15171943-15171965 11:15171968-15171990
Sequence CCAGGGGCATTTTAACACAGACT ACATGGCCACAGATGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120} {0: 1, 1: 1, 2: 6, 3: 42, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!