ID: 1078926753_1078926757

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1078926753 1078926757
Species Human (GRCh38) Human (GRCh38)
Location 11:15882011-15882033 11:15882043-15882065
Sequence CCCGGATCTCAATTTGATTTGTG CTTTCAACTGAGAGGTAACATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!