ID: 1078961444_1078961455

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1078961444 1078961455
Species Human (GRCh38) Human (GRCh38)
Location 11:16277308-16277330 11:16277348-16277370
Sequence CCCACCCACTCCACCATGTGAGG GAAGACAGAGATCTTCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 308} {0: 1, 1: 0, 2: 2, 3: 19, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!