ID: 1079011307_1079011313

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1079011307 1079011313
Species Human (GRCh38) Human (GRCh38)
Location 11:16830684-16830706 11:16830711-16830733
Sequence CCATTCACCATGTATTTACCAAG TATACAGCCCCCACTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 257} {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!