ID: 1079052299_1079052303

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1079052299 1079052303
Species Human (GRCh38) Human (GRCh38)
Location 11:17172794-17172816 11:17172831-17172853
Sequence CCTCCACTTCATCATCGGTGATT GTTAACTTATTTACTTGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126} {0: 1, 1: 0, 2: 3, 3: 28, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!