ID: 1079067381_1079067384

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079067381 1079067384
Species Human (GRCh38) Human (GRCh38)
Location 11:17307290-17307312 11:17307343-17307365
Sequence CCATCCTCCTTGGGTTTATCTAT GACGTTTTGCTATGTTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 245} {0: 2, 1: 8, 2: 417, 3: 5831, 4: 34659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!