ID: 1079131562_1079131568

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1079131562 1079131568
Species Human (GRCh38) Human (GRCh38)
Location 11:17749784-17749806 11:17749798-17749820
Sequence CCCTGACCCCTGTTCAGCCCCAA CAGCCCCAACACCTGGAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 228} {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!