ID: 1079159333_1079159339

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1079159333 1079159339
Species Human (GRCh38) Human (GRCh38)
Location 11:17977658-17977680 11:17977674-17977696
Sequence CCTAACCCTTAATATTATGGAGA ATGGAGACAAGGCCTGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 176} {0: 1, 1: 0, 2: 2, 3: 40, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!