ID: 1079195584_1079195588

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1079195584 1079195588
Species Human (GRCh38) Human (GRCh38)
Location 11:18323526-18323548 11:18323560-18323582
Sequence CCTTTGTCCATTTGAAGACCCAG AAAACAAAAAAAAAACTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 263} {0: 1, 1: 3, 2: 291, 3: 4011, 4: 28825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!