ID: 1079243152_1079243157

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1079243152 1079243157
Species Human (GRCh38) Human (GRCh38)
Location 11:18734949-18734971 11:18735000-18735022
Sequence CCTGATTCTGACTTACTAGCAGT CTGTGCCTTATCTGTAATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 0, 2: 4, 3: 26, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!