ID: 1079292362_1079292370

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1079292362 1079292370
Species Human (GRCh38) Human (GRCh38)
Location 11:19199764-19199786 11:19199799-19199821
Sequence CCATCCTCAATGCCCTTTAAGAC CCTTCCTGCCATTCTTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152} {0: 1, 1: 0, 2: 4, 3: 33, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!