ID: 1079322123_1079322126

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1079322123 1079322126
Species Human (GRCh38) Human (GRCh38)
Location 11:19459826-19459848 11:19459872-19459894
Sequence CCACAGAATGTTTTTGAGCAAGA CTTAGGATGATTAATACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 389} {0: 1, 1: 0, 2: 0, 3: 2, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!