ID: 1079347426_1079347429

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1079347426 1079347429
Species Human (GRCh38) Human (GRCh38)
Location 11:19665149-19665171 11:19665181-19665203
Sequence CCTGATGCCAAATCAAGAGAACA ACTCAAATCCAAGAAGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 264} {0: 1, 1: 0, 2: 3, 3: 21, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!