ID: 1079357478_1079357492

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079357478 1079357492
Species Human (GRCh38) Human (GRCh38)
Location 11:19742147-19742169 11:19742200-19742222
Sequence CCTCCTGAGCCCCTTATACTCCA ACTCAGCAGTCATCGGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160} {0: 1, 1: 0, 2: 2, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!