ID: 1079391424_1079391430

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1079391424 1079391430
Species Human (GRCh38) Human (GRCh38)
Location 11:20025124-20025146 11:20025166-20025188
Sequence CCCTGGCACCTTGGGCAGGTCAC GTTTCCACATCTATCCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 106, 4: 544} {0: 1, 1: 0, 2: 6, 3: 81, 4: 856}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!