ID: 1079409212_1079409223

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1079409212 1079409223
Species Human (GRCh38) Human (GRCh38)
Location 11:20171392-20171414 11:20171445-20171467
Sequence CCAGGTGTGCATGTTTAGCCATA CCACACTCACTCACAAGGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!