ID: 1079429352_1079429358

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1079429352 1079429358
Species Human (GRCh38) Human (GRCh38)
Location 11:20374081-20374103 11:20374119-20374141
Sequence CCAGGTGGTGGATATAGTTAAAA ATGGGAAAGGAGGATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120} {0: 1, 1: 1, 2: 13, 3: 180, 4: 1490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!