|
Left Crispr |
Right Crispr |
| Crispr ID |
1079437270 |
1079437272 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:20470123-20470145
|
11:20470148-20470170
|
| Sequence |
CCTAGGTTACAAACCTGTACAGC |
GTTACTGTATTTACAACTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 28, 1: 495, 2: 1255, 3: 1622, 4: 3715} |
{0: 1, 1: 0, 2: 0, 3: 38, 4: 392} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|