ID: 1079437720_1079437726

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1079437720 1079437726
Species Human (GRCh38) Human (GRCh38)
Location 11:20474517-20474539 11:20474556-20474578
Sequence CCAGCGGCTGCTCTGCCAGGACT TATTGGACCGAAGGCCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194} {0: 1, 1: 9, 2: 29, 3: 68, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!