ID: 1079799813_1079799818

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1079799813 1079799818
Species Human (GRCh38) Human (GRCh38)
Location 11:24854712-24854734 11:24854735-24854757
Sequence CCAAACAACTGCCCCATTTTGTG CTTGAAACCCAGTGCCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 135, 4: 366} {0: 10, 1: 576, 2: 638, 3: 386, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!