ID: 1079933248_1079933258

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1079933248 1079933258
Species Human (GRCh38) Human (GRCh38)
Location 11:26590768-26590790 11:26590806-26590828
Sequence CCCTGCTGGATCCGGAGGGGTGG CTGCAAATGGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 17, 1: 68, 2: 120, 3: 148, 4: 241} {0: 1, 1: 1, 2: 9, 3: 134, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!