ID: 1079962625_1079962626

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1079962625 1079962626
Species Human (GRCh38) Human (GRCh38)
Location 11:26942874-26942896 11:26942911-26942933
Sequence CCAACAAGGAAGTCTAAATAGAA CTCATATGCTTTTGTTGACACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!