ID: 1080007058_1080007066

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1080007058 1080007066
Species Human (GRCh38) Human (GRCh38)
Location 11:27420743-27420765 11:27420762-27420784
Sequence CCTCTGAACTAGATAATGTGTGT GTGTCTTGGGGGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171} {0: 1, 1: 0, 2: 5, 3: 45, 4: 785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!