ID: 1080008864_1080008867

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1080008864 1080008867
Species Human (GRCh38) Human (GRCh38)
Location 11:27437542-27437564 11:27437569-27437591
Sequence CCTGCAAGAACAGGGACTAGATC CTTCCAATCCTTGTAATGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101} {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!