ID: 1080087336_1080087339

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080087336 1080087339
Species Human (GRCh38) Human (GRCh38)
Location 11:28300028-28300050 11:28300067-28300089
Sequence CCTAATCTTAACTTGATTATATC CTAGGTCAGATCACATTTATAGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 189, 3: 395, 4: 957} {0: 1, 1: 0, 2: 1, 3: 9, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!