ID: 1080150264_1080150270

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1080150264 1080150270
Species Human (GRCh38) Human (GRCh38)
Location 11:29044547-29044569 11:29044579-29044601
Sequence CCATAAAAAAAGAATGAGATCGT GGGAACCAGGATGGAGCTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 254, 3: 1155, 4: 3720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!