ID: 1080337204_1080337207

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1080337204 1080337207
Species Human (GRCh38) Human (GRCh38)
Location 11:31211120-31211142 11:31211156-31211178
Sequence CCACCATGACTTCATGAGCATAT TTTAGCAATCAGACTGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197} {0: 1, 1: 0, 2: 3, 3: 9, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!