ID: 1080372693_1080372695

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1080372693 1080372695
Species Human (GRCh38) Human (GRCh38)
Location 11:31670246-31670268 11:31670261-31670283
Sequence CCAACTGAGCATTTAAAATGTAC AAATGTACCCTTCAAATTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 271} {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!