ID: 1080383339_1080383354

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080383339 1080383354
Species Human (GRCh38) Human (GRCh38)
Location 11:31796428-31796450 11:31796467-31796489
Sequence CCGAAGAGCGGGCGCCTCCGTGC CTGGGGGGATGGAGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30} {0: 1, 1: 0, 2: 29, 3: 285, 4: 2483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!