ID: 1080402380_1080402384

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1080402380 1080402384
Species Human (GRCh38) Human (GRCh38)
Location 11:31947818-31947840 11:31947848-31947870
Sequence CCACATCCATAGGAAAAGAGGGA ACATCAAGGGAACACCCCATAGG
Strand - +
Off-target summary {0: 13, 1: 148, 2: 269, 3: 295, 4: 478} {0: 98, 1: 246, 2: 333, 3: 388, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!