ID: 1080405293_1080405300

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1080405293 1080405300
Species Human (GRCh38) Human (GRCh38)
Location 11:31973317-31973339 11:31973350-31973372
Sequence CCCTCGGCCCTCTAGGCAAATTG GGAATCTCCCTCGTGCTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49} {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!