ID: 1080456631_1080456637

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1080456631 1080456637
Species Human (GRCh38) Human (GRCh38)
Location 11:32425438-32425460 11:32425477-32425499
Sequence CCATTACATTCACAAAAGCATTT TTGTTTAGGAGTAGGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 435} {0: 1, 1: 0, 2: 2, 3: 42, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!