ID: 1080493598_1080493607

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1080493598 1080493607
Species Human (GRCh38) Human (GRCh38)
Location 11:32794475-32794497 11:32794504-32794526
Sequence CCCCTTGGCAACCAGAGCAAGGA GGTTACGCAGCTGGAGGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232} {0: 1, 1: 0, 2: 3, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!