ID: 1080594242_1080594244

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1080594242 1080594244
Species Human (GRCh38) Human (GRCh38)
Location 11:33755388-33755410 11:33755429-33755451
Sequence CCACTGAACAAAGTTTTAAAAGT ATGAATCAAAGGATGTTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 582} {0: 1, 1: 0, 2: 2, 3: 14, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!