ID: 1080635614_1080635619

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1080635614 1080635619
Species Human (GRCh38) Human (GRCh38)
Location 11:34120923-34120945 11:34120955-34120977
Sequence CCCTGTGGCTCTTGGGGAGCCAC CAGAGGAAGCAGCATGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 192} {0: 1, 1: 1, 2: 37, 3: 135, 4: 674}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!