ID: 1080660096_1080660100

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1080660096 1080660100
Species Human (GRCh38) Human (GRCh38)
Location 11:34288843-34288865 11:34288883-34288905
Sequence CCTTCCTCTGGACGTTCCTGCAT AGTGACCTTCATAGTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 140} {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!