ID: 1080676857_1080676861

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1080676857 1080676861
Species Human (GRCh38) Human (GRCh38)
Location 11:34435891-34435913 11:34435919-34435941
Sequence CCTTAGCATAGCTCATGCTATGG ACCAGACACCAGAGGACATCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!