ID: 1080728661_1080728663

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1080728661 1080728663
Species Human (GRCh38) Human (GRCh38)
Location 11:34923812-34923834 11:34923837-34923859
Sequence CCTGATTTGGCTTTTAGCTTTGG GTGAATAGTATGAGCACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 411} {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!